DNA Molecular Weight Calculator
Paste a DNA sequence (A/T/C/G/ or IUPAC ambiguous codes); the tool instantly computes molecular weight (MW), base count, length and extinction coefficient, and estimates OD and mass for a given concentration.
Input Data
Results
At a glance:The molecular weight (relative molecular mass, MW) of a DNA fragment is the sum of the relative atomic masses of all its atoms — the mass of one molecule in 'g/mol' (relative to a unified atomic mass unit). For a short single-stranded DNA oligonucleotide (primer/probe) the exact MW is computed from the nucleotide residues: a free ssDNA is formed by linking mononucleotides through phosphodiester bonds, and each bond 'consumes' one molecule of water (H₂O, 18.015 g/mol), so the sum of all mononucleotide molecular weights must subtract (n − 1) × 18.015 to equal the residue MW. In practice we usually sum the average 'nucleotide residue weights' (mononucleotide minus one water) directly: roughly A≈313.21, T≈304.20, C≈289.18, G≈329.21 (base + deoxyribose + phosphate), while average values for ambiguous bases are N≈308.95, R≈321.21, Y≈296.69, etc. (the exact value varies slightly across databases). The MW of a DNA segment is essentially proportional to its length; a 20-mer is about 6 kDa and a 100-mer about 30 kDa. The 'length' of a DNA is its nucleotide count (nt); by the base-pairing rule A pairs with T and G with C, a double-stranded DNA of n bp ≈ 660 g/mol per bp (≈ 618 for the two strands' residues). Because DNA absorbs ultraviolet light at 260 nm (due to the bases), given its molar extinction coefficient ε260 (L·mol⁻¹·cm⁻¹) we can estimate the solution concentration: A260 = ε × c × l (l is the cuvette path length, usually 1 cm), so c = A260/(ε × l); this is the principle of nucleic-acid quantification by spectrophotometer and Nanodrop. The 'extinction coefficient' is derived from the nearest-neighbour dinucleotide model and depends strongly on sequence, so a precise ε260 must be computed from the actual sequence. Using this tool's default (20-mer ATCGATCGATCGATCGATCG): length 20 nt, MW ≈ 6080 g/mol, ε260 ≈ 197 000, with default 100 µM giving OD260 ≈ 1.97 and mass per µmol ≈ 6.08 µg. Notes: MW here is the single-strand value, and dsDNA requires summing both strands or using the bp estimate; the input should be plain A/T/C/G (ambiguous codes use average residue weights and are approximate); 5′ phosphorylation, fluorescent labels, modifications and salts notably shift the true mass and are not covered. In short, the DNA molecular-weight calculator converts 'sequence text' into MW, length, extinction and mass in one step — the foundation of primer design, probe synthesis and qPCR quantification.
Formula
Single-strand MW ≈ Σ residue weight − (n − 1) × 18.015 (or sum of residue weights directly).
Residue weights (average): A≈313.21, T≈304.20, C≈289.18, G≈329.21 (g/mol).
Molar extinction A260 = ε260 × c × l (l = 1 cm path length); concentration c = A260/(ε260 × l).
Mass per µmol = MW ÷ 10⁶ × 1000 (µg), i.e. MW (g/mol) → µg/µmol = MW/1000.
$$M_{\text{ssDNA}} \approx \sum w_{\text{residue}} - (n-1)\times 18.015$$$$A_{260} = \varepsilon_{260}\, c\, l$$How to Use
- Paste the DNA sequence (A/T/C/G or IUPAC codes), case-insensitive; non-letters are ignored.
- The right panel instantly shows length, single-strand MW and molar extinction ε260.
- Enter the estimated concentration (default 100 µM) to get OD260 and mass per µmol.
Average nucleotide residue weights and typical lengths
| Base | Residue Weight (g/mol) | Note |
|---|---|---|
| A | 313.21 | Adenine residue (minus H₂O) |
| T | 304.20 | Thymine residue |
| C | 289.18 | Cytosine residue |
| G | 329.21 | Guanine residue (heaviest) |
| N (avg) | 308.95 | Average of ATGC |
MW = Σ residue weights (minus water already accounted in residue values); dsDNA ≈ 2× ssDNA MW or ≈ 660 × bp.
Case Studies
A 20-mer standard primer
Sequence ATCGATCGATCGATCGATCG, length 20 nt.
Single-strand MW ≈ 6080 g/mol, ε260 ≈ 197 000 L·mol⁻¹·cm⁻¹.
At default 100 µM, OD260 ≈ 1.97 (≈ 2.0), mass per µmol ≈ 6.08 µg — typical primer-spec numbers in synthesis reports.
Rough MW estimate for a 100-mer
Assuming average residue ≈ 304.2, 100 nt MW ≈ 100 × 304.2 ≈ 30 420 g/mol (≈ 30 kDa).
Exactly double for dsDNA ≈ 60 kDa; a useful order-of-magnitude check for cloning and PCR product mass.
For precise design use the actual sequence and correct residue weights rather than the average.
FAQ
How is DNA molecular weight computed?
For a single-stranded oligonucleotide, sum the residue weights of each nucleotide (mononucleotide minus one water lost per phosphodiester bond), or sum the mononucleotide molecular weights and subtract (n − 1) × 18.015. Ambiguous bases use average residue weights and are approximate.
Why subtract water?
Linking mononucleotides into a chain forms phosphodiester bonds, each releasing one H₂O (18.015 g/mol). So the total molecular weight equals the sum of mononucleotide weights minus the water lost during condensation; using 'residue weights' already bakes in this subtraction.
What is the extinction coefficient and how is it used?
The molar extinction coefficient ε260 (L·mol⁻¹·cm⁻¹) describes how strongly DNA absorbs at 260 nm. With absorbance A260 = ε260 × c × l (l = 1 cm path), the concentration c = A260/(ε260 × l). It is computed from the sequence's nearest-neighbour model and depends on sequence.
What is the difference between ssDNA and dsDNA molecular weight?
This tool returns single-strand MW. Double-stranded DNA of n base pairs has MW ≈ 2 × ssDNA residue sum, commonly estimated as ≈ 660 g/mol per bp. For accurate dsDNA use the actual two-strand sequence.
Does it support lowercase and ambiguous codes?
Yes, uppercase and lowercase are both accepted and non-letter characters are ignored. IUPAC ambiguity codes (N, R, Y, S, W, K, M, B, D, H, V) are supported using average residue weights, which is slightly approximate.
Related Tools
References
Content review: Calculatorism Science Team. Results are for reference only; please refer to the relevant authorities for the official figures.